Overblog
Editer l'article Suivre ce blog Administration + Créer mon blog
6 avril 2020 1 06 /04 /avril /2020 10:12
Voici le mail de Bernard en direct du labo du CHU de Nantes
Des nouvelles du front et du heros-mais-pas-trop-quand-même-faut-pas-pousser
La vague attendue n'est toujours pas arrivée malgré l'augmentation régulière des positifs dans nos séries de tests, et personne ne s"en plaindra: le confinement précoce de la région avant une trop grande répartition du virus dans la population y est surement pour qq chose. Mais rien ne nous dit comment va évoluer cette saloperie! restez vigilants et ne lachez rien le virus est partout. La semaine à venir peut être différente!
A propos des tests Covid19, je me suis dit que vous aimeriez peut être savoir comment ça se passe. Il ne faut pas compter sur Ouest France pour vous l'expliquer... Alors je vous joins un document pour tenter de vous expliquer simplement la technique PCR utilisée au labo. Vous avez aussi le droit de le mettre à la corbeille: il n'y aura pas de contrôle écrit à la rentrée!!
Prenez soin de vous et de vos proches
Bernard
Des nouvelles du front et autres

Bonjour, J'ai récemment lu ça sur Ouest France : on vous a montré cette photo avec la légende : « test du Covid19 » ça m'a énervé... ça a l'air tellement simple qu'on se demande pourquoi on n'en fait pas à toute la population ! Seulement voilà, c'est juste un tout petit peu plus compliqué ! Ce tube contient seulement un liquide et l'écouvillon avec lequel on a prélevé dans le nez du patient. Il permet de transporter et protéger les cellules et les virus qu'il contient vers le labo où sera fait l'analyse. Comment se fait le test ? 2 étapes : 1 récupérer les acides nucléiques (ADN et ARN) qu'il contient 2 aller à la pêche pour amplifier l'ARN du Covid19 (PCR) 1- purification : après avoir bien touillé le liquide avec l'écouvillon, on récupère 0,2ml qu'on met immédiatement dans un tube qui contient une solution pour détruire les cellules et l'enveloppe du virus qu'elles contiennent pour libérer les acides nucléiques (AN : ADN et ARN). Là le virus est mort et on ne risque plus rien. Cette « soupe » est placée dans un automate qui va récupérer les AN et les dissoudre dans un liquide propre. Ca prend 45mn 2 On récupère 0,005ml (C pas bcp) de ce liquide que l'on dépose dans un nouveau tube qui contient 0,020ml d'un mélange où on va amplifier l'ARN du virus pour qu'il soit détectable. A l'échelle moléculaire, c'est repérer un gardon dans le lac de Genève

Comment ça marche : je vais prendre un exemple Vous voyez le lac de St julien (plus petit), il est plein de poissons différents et celui qu'on cherche est bien planqué avec les autres beaucoup plus nombreux. Alors on va multiplier le nombre de poissons Covid19 pour le démasquer : Si le Covid19 est présent, on va l'accrocher avec une amorce qui ne s'accroche qu'à lui et à partir d'un poisson Covid19, on va en créer 2, avec les 2 on en fait 4, avec les 4 on en fait 8, et ainsi de suite:16, 32, 64, 128, 256, 512, 1024 quand on a fait ça 45 fois, (45 cycles) on peut mathématiquement en avoir 2 exposant 45 ça fait beaucoup ! C'est ce qu'on appelle une réaction en chaîne (PCR : Polymerase Chain Reaction) on vous parle des fois du test PCR et bien c'est ça. Il faut 1h30 dans un automate : le thermocycleur Ben oui mais comment on les voit les nouveaux poissons ? me direz vous Imaginez : à chaque fois qu'on crée un nouveau poisson, on allume une led dans le lac de St Yo, on place un drone avec une camera au dessus du lac qui va pouvoir détecter l'augmentation de la lumière

En vrai ça donne ça : courbe de l'intensité lumineuse

 

 

Des nouvelles du front et autres

Ici la lumière (fluorescente) à été détectée dans le tube à partir du 25ème cycle et ils ont fait 50 cycles d'amplification. Évidemment plus vous avez de virus au départ et moins vous aurez besoin de cycles pour atteindre le seuil de détection, ça donne une idée du nombre de virus présents dans le prélèvement. En plaçant dans la série des tubes qui contiennent une quantité connue d'ADN viral, on peut même calculer le nombre de virus contenus dans l'échantillon de départ. Un peu de biologie moléculaire (si ça vous échappe demandez à vos bacheliers de l'année) Vous connaissez les briques (bases) qui composent l'ADN : A T C G L'amorce qui accroche le poisson c'est un petit morceau d'ADN avec une suite de 20 bases ATCG que l'on a fabriqué à partir de la séquence complète du génome viral publié par les chinois. GGCATTCGGACCTGATGGCATGCCCTTACCetc-------(genome du virus) TAAGCCTGGACTACCGTAC (amorce) le A s'accroche au T et le G s'accroche au C cette suite de bases a été choisie pour être unique et caractéristique du virus, elle ne peux pas accrocher aucune autre séquence. Une fois accroché, la suite de la multiplication de la séquence du virus se passe aussi au niveau de la séquence en utilisant des A T C G ,une enzyme (polymerase) qui va les accrocher en face de la séquence ciblée à partir d'amorces spécifiques. On utilise un marqueur fluorescent qui va émettre de la lumière à chaque nouvelle copie réalisée. Il y a des vidéo et des Schéma explicatifs sur le net, je pourrai aussi vous en dire plus si ça vous intéresse. Je vous remercie d'avoir lu jusqu'au bout (le mélange pour faire la PCR est fabriqué au labo, y'a pas que les allemands qui sachent faire ça!)

Et Voici le mot que  Céline m'a envoyé :

Tout d'abord merci de maintenir les liens du club en alimentant le site. 

Les petits mots des uns et des autres sont forts et fédérateurs.

De mon côté à  défaut de transpirer en faisant du sport ,

le sport m'a inspirée, alors à mon tour je partage ce petit texte, un jeu qui pourra si tu le souhaites être proposé à nos sportifs du RCN   

Des nouvelles du front et autres
Des nouvelles du front et autres
Des nouvelles du front et autres
Des nouvelles du front et autres

Et ma  dernière aquarelle

et pour en voir plus:

http://c-theo.over-blog.com/

et   sitartheo

Des nouvelles du front et autres

Partager cet article

Repost0

commentaires

jacqueline denis 07/04/2020 18:06

un grand merci à Bernard pour ses explications très complètes et lumineuses sur le test du covid19
Comme quoi les choses sont parfois beaucoup moins simples que l'on ne pourrait penser...
Merci aussi à tous ceux qui nous font rire
Jacotte