Suivre ce blog Administration + Créer mon blog
2 mai 2020 6 02 /05 /mai /2020 11:05
Le Salon de Séverine

Partager cet article
29 avril 2020 3 29 /04 /avril /2020 14:41

Eh oui, un an ça passe vite, et notre artiste, avec plein de cordes à son arc, peintre, guitariste, webmaster, imitateur, chanteur... et bien sûr coureur, trailer, marcheur, nageur, n'échappe pas à la règle. Un an de  plus aujourd'hui, alors, comme on ne peut pas te le dire de près,  toutes les copines et copains te disent bon anniversaire Théo sur ce blog que tu animes, qui maintient le lien entre tous et fait de la section une grande famille.


Partager cet article
29 avril 2020 3 29 /04 /avril /2020 13:40

Brigitte et Alain ont déjà participé à la précédente édition du 19 Avril.

Ils vous invitent à vous inscrire pour la finale.

Bonjour à Tous,

Pour ce printemps 2020, pas de trail et de course à pied, coronavirus oblige!

Une formule particulière pour participer à une course sur vos terres, vos jardins, balcons et se retrouver, renouer avec les copains de  course, bien entendu virtuellement.

Cette épreuve vous est proposée par Time Pulse, notre partenaire aux Sentiers des Vignes…

Alors, si ça vous dit, vous avez le choix un 10kms ou un 5kms pour ceux et celles qui ont abandonné leurs chaussures depuis le 14 mars. L’inscription est modique (3€) mais vous pouvez y rajouter un don en direction de deux associations caritatives (Association L'enfant Bleu - Enfance Maltraitée et La Fondation de France).

Les places sont limitées et il en reste peu, si l’idée vous plait, ne tardez pas ! Il y a un challenge par équipe, mais ça va être dur de rattraper Montaigu.

Alors, on se bouge ?



Et un petit mot d’Amélia

Ce que j’ai envie de retenir de cette période de confinement, c’est ce bel élan de solidarité qui s’est mis en place un peu partout ainsi que tous ces talents et créativités qui se sont révélés ou se sont développés…

Mettre en avant le positif et la beauté de l’humain, de la nature et de tout ce qui nous entoure : c’est vraiment chouette et ça m’émeut !


Partager cet article
27 avril 2020 1 27 /04 /avril /2020 14:36

Bonjour à tous,


Ne vous inquiétez pas, je ne vous oublie pas ; c’est seulement que je n’ai plus grand-chose à dire côté sport et vous non plus sans doute car je ne reçois plus de nouvelles.


C’est vrai que la situation est toujours préoccupante et que chacun se bat dans son coin avec sa situation propre.


Je pense d’abord aux licenciés/ées dont la profession est de soigner, à ceux qui travaillent dans des milieux en contact avec le public, à ceux qui sont inquiets pour leur avenir professionnel, à ceux qui ont des personnes touchées par le virus, à ceux qui ont des personnes de leur famille touchées par d’autre maladies et ne peuvent subir des interventions nécessaires dans l’immédiat, à ceux dont les parents ou grands parents sont en Ehpad ou en foyer logement sans possibilité de les visiter.


Je pense aussi aux personnes en télé travail à la maison avec les enfants dont ils doivent veiller à ce que le travail scolaire soit bien réalisé tout en assurant les courses et les repas ; et ceux qui doivent assurer aussi auprès de leurs enfants en bas âge ne pouvant être gardés par les nounous ou les grands parents.

Aussi à ceux qui vivent dans des appartements étroits.


Personnellement, je ne fais pas partie de ceux qui sont le plus à plaindre, mais il faut tout de même lutter contre le risque de s’ennuyer et aussi de déprimer.

Nous avons aussi nos enfants et petits enfants que nous ne pouvons voir qu’en vidéo conférence. Sans compter les cas précités de maladies de proches.


Je voulais vous dire que je pense beaucoup à vous et comme vient de me l’écrire Bertrand G la grande famille du RCN Loire Divatte me manque aussi.


Mais il faut regarder vers l'avenir, qui nous l'espérons tous verra le bout de cet épisode.

Sans doute ne vivrons nous pas comme avant, il faudra tout repenser, tout restructurer et organiser avec de nouvelles façons de faire.


Gardons le moral !


Vous vous rappelez sans doute qu’il y a un an (samedi 27) se couraient les Foulées de l’Éléphant et le lendemain (dimanche 28) le Marathon de Nantes.


Je vous invite à retrouver les articles concernés du temps ou nous étions encore heureux comme le dit si bien Calojero.

Et maintenant

LE COIN POÉSIE avec Stéphane S


À toi sentier des vignes

Cette année sentier des vignes, nous n'écrirons pas ton histoire
Nous devons tristement, mais momentanément te ranger dans un tiroir
Pas d'inquiétude , cette mise à l'écart n'est que conservatoire
Dans ce monde ou alterne la réalité , le virtuel et le contradictoire
Cette mesure heureusement n'aura rien de rédhibitoire
En 2021 Bertrand Alain Rémi Bernard...te construirons une nouvelle trajectoire
Avec impatience nous rassembleront les inscriptions dans nos répertoires
Et en ce nouveau mois d'avril nos visages rayonnants

seront porteurs d'espoir
 Nous récrirons une nouvelle page de ton histoire
Pour nous ouvrir pour notre plus grand bonheur,

les portes du sentier de la gloire.

Et aussi


Les aquarelles du confinement... dans le jardin

Voir les commentaires

Partager cet article
17 avril 2020 5 17 /04 /avril /2020 17:05

Voilà ce que Bernard nous écrit.

Rappel pour ceux qui n'auraient pas lu les articles précédents.

Bernard retraité du labo du CHU avait été appelé en renfort au début de l'arrivée du Covid 19.


Des nouvelles du front suite et fin. Retour du guerrier au terme d'un mois de reprise. Bravo à tous, la région est restée bien confinée du coup la vague attendue à été bien rabattue et l'hôpital peut faire face sereinement pour la suite. Car ce n'est pas terminé ! Pas de relâchement il circule toujours activement autour de nous il attend juste une ouverture pour nous tomber dessus ! Comme vous avez pu le lire dans la presse, un automate chinois et les tests qui vont avec va être installé au chu reste à recruter l'équipe qui va l'alimenter mais là mon petit coup de main à ses limites alors retour à la retraite et place aux jeunes! Cette équipe doit être opérationnelle pour suivre le déconfinement au 11 mai. 
Merci pour votre soutien et RDV pour la chaise contre le mur du gymnase dès que possible... 
Et le mot de Stéphane S
Préface de Théo
Merci Stéphane pour ton message très sympathique qui fait du bien à ceux qui œuvrent pour que chacun se sente à l'aise dans la section ; surtout au moment de l'accueil des nouveaux licenciés.
C'est le résultat d'une équipe soudée des membres du bureau, des entraineurs et de tous les athlètes qui répondent présents lorsqu'on a besoin d'eux.
Sans oublier Yveline qui mène de main de maitre avec une très grosse dépense d'énergie la section, attentive à tous et à toutes les catégories de licenciés.
Désormais, Stéphane tu es un rouage dans cette équipe ou tu as déjà apporté ton expérience dans son organisation.
Je mettrais toutefois un bémol à tes louanges.
Je pense que tu as voulu me taquiner en me nommant légende du club plein de sagesse.
Les gens qui me connaissent bien savent que je ne suis pas toujours très sage et qu'être une légende me donne l'impression d'avoir un pied dans le passé.

 Bonjour à tous,

Bilan confinement  ou plus exactement mettre à profit le temps de cette épreuve pour faire  un come back de mes bientôt 4 années au RCN.

Cela faisait plus de 40 années que je n'avais plus gouté au bien fait de la vie d'un club. Le message affiché sur les panneaux d'information en été, fut le détonateur de mon arrivée au club, mon premier contact en septembre 2016 fut Jacques, homme précieux dans les rouages de ce club, ensuite Théo devenu pour moi aujourd'hui comme la légende vivante du club par sa sagesse et son charisme tranquille. Et puis bien sur notre présidente à toutes et tous , femme plus que dévouée, volontaire, combative et on le sait toutes et tous que ce club lui appartient encore plus que nous par son implication énormissime. Je pense aussi à Patrice organisateur hors pair et personne sensible très attachante.

Je n'aurais jamais pensé être un jour membre d'un bureau ou d'une organisation et cela c'est grâce à vous et à toutes les personnes et bénévoles qui œuvrent pour que ce club, les coachs et toutes les personnes bienveillantes dans l'organisation du sentiers des vignes.
Alors ce soir en plus que d'applaudir les personnels dévoués pour sauver nos vies je vous applaudi toutes et tous pour votre bonne humeur lors des entrainements et repas.
Respectueusement et sportivement

Et l'aquarelle N° 6 du confinement.

Le retour du guerrier et un mot de Stéphane S
Partager cet article
13 avril 2020 1 13 /04 /avril /2020 09:31





299.    CHEVALIER Benoît         00:46:53 /12,80                  Merci aux soignants !

370.    ESNAULT Alain              00:48:30 /12,37                          Très bonne idée solidaire. Merci à Mikael et toute l'équipe

885.    ESNAULT Brigitte     01:00:57 /9,84                              Très belle initiative de TimePulse 

933.    CUSSONNEAU Corinne   01:03:50 /9,40   


Partager cet article
11 avril 2020 6 11 /04 /avril /2020 14:27
J’ai une solution pour allier sport et apéro, 
en plus quand tu as la fumée tu te croirais dans 
l’ascension du Tourmalet 😂
Aneto Trail

de la part d'Olivier:

Voici un lien avec quelques info sur l’Aneto Trail par rapport au covid 19 

Virtual Challenge by TimePulse

C'est une course de 10km courue autour de ou chez soi.
Les bénéfices sont versés aux équipes du CHU de Nantes


Virtual Challenge by TimePulse#2 dans toute la France » TimePulse - Inscription en ligne et chronométrage sportif

Aneto Trail

Un peu de musique avec François dans son quatuor de cordes

Il s'agit la d'une reprise de la chanson La nuit je mens de Bashung.....le quatuor intervient à la 3eme minute
mais c'est toujours agréable d'entendre des cordes, dans un groupe de rock.....
La nuit je mens / Cachemire / hommage à A.Bashung

L'Aquarelle de Théo


Deux écoliers au Sri Lanka d'après une photo prise par mon fils .


Aneto Trail
Partager cet article
9 avril 2020 4 09 /04 /avril /2020 08:30


Catherine B nous donne de ses nouvelles et propose...

J'espère que vous vous portez bien pendant ce confinement. Ça fait du bien d'avoir des nouvelles des gens par le blog que tu alimentes donc bravo Théo, bravo Bernard pour ton dévouement et bravo à tous les gens qui œuvrent pour faire avancer les choses dans une période que nous n'avons jamais connue.


De mon coté étant en chômage partiel cette semaine, je m'occupe comme je peux.

 Étant de nature à ne pas tenir en place (pour ceux qui me connaissent bien 😂), j'ai passé par mal de temps en cuisine ces jours-ci. Bah oui je suis très gourmande donc j'ai fait du pain, des brioches, des gâteaux, des pizzas etc. Bref à un moment faut se remuer le popotin !!!! Sinon à la reprise de la course ça va être terrible 😖


Donc cet après midi à 17h, j'ai décidé de courir autour de la maison (tout en respectant le confinement) et de faire mes 10 kms.

 Sachant que le tour fait à peu près 85 mètres, j'ai fait environ 120 tours.

 Je t'ai transféré quelques photos (preuves à l'appui).

 Que penses-tu de proposer un défi au RCN à St Julien ? Je suggère que les coureurs fassent aussi leur petit défi et qu'ils le partagent sur le site par ton intermédiaire, si bien sur cela ne te dérange pas !!! Ça serait sympa


PS : Pensez à courir dans les 2 sens, moi j'avais les pneus qui commençaient à chauffer au bout d'un moment 😂


Réponse de Théo :

Oui, pourquoi pas ?

Avant hier j'ai eu la même idée que toi en voyant le mail de Time Pulse qui organise un 10 km.

Vous vous inscrivez, faites un don qui est destiné à aider le CHU Nantes.

Vous avez du le recevoir.

Pour voir ce que çà donne, j'ai  mis ma montre GPS pour mesurer le tour de mon jardin en faisant le tour et en prenant escaliers, allées etc.

J'arrive à 120m. Il faut donc faire 84 tours.

J'ai peur que les voisins me prennent pour un dingue.

je crois que je vais me déguiser pour qu'il ne me reconnaissent pas.

Faites un vœu avec Benny Hill

Et beaucoup plus sérieux, Stéphane vous invite à réfléchir…


Cécilia a raison, il faut bien respecter les règles de confinement, mais est ce que le respect des règles est une permanence chez l'homme en général ?
Toute la question est posée avec cette situation ou la réalité dépasse la fiction, sommes nous un peuple responsable comme certains politiques le laissent entendre, certainement dans le seul but de s'octroyer de nouveaux électeurs ?
La réponse à cette question est loin d'être évidente, tant nos sensibilités et idéaux sont différents, et pourtant face à l'épidémie actuelle, pourquoi ne pas tenter cette analyse: en 2019 environ 620000 décès en France, nombreux meurent sur la route et souvent la vitesse comme responsable ou sous l'emprise d'alcool et stupéfiant .combien de décès liés aux excès, tabac alcool et ce n'est pas faute de responsabiliser par des campagnes incitant à la sagesse de chacun. Le monde médical s'interfère même parfois avec des contradictions que l'on vit actuellement et sème le doute dans les esprits. Et puis tout le monde se renvoie les responsabilités car nombreux sont les donneurs de leçons, les prévoyants ou autres voyants !!! Qui auraient mieux fait que le commun des mortels. Sans oublier les médias colporteurs de messages devenus aujourd'hui plus conflictuel que rassembleurs, basés plus sur la polémique que la véritable information.
Je pense qu'il faut aujourd'hui que chacun et chacune remettent de l'ordre dans ses idées, le confinement est le moment idéal.
Bonne journée Stéphane

Voir les commentaires

Partager cet article
7 avril 2020 2 07 /04 /avril /2020 13:25

Un petit mot de Cécilia adressé à Bernard

Ce mot est pour Bernard. Merci Bernard de nous donner les nouvelles du front, tu aurai du être prof. Je suis heureuse de voir et/ou connaitre des gens comme toi, qui donnent de leur temps et de leur connaissance avec le but d'aider tout le monde. Nous avons besoin les uns des autres. Merci de ne pas sortir, c'est très difficile de résister à l'appel de la nature, mais il faut penser à sa santé et à celle des autres. Moi, je ne suis pas sortie une seule fois courir depuis le debout du confi, ça me manque, mais il faut être vigilants car le plus dur reste à venir. Confinés c'est mieux que Cons finis ;-)
Cécilia ‌


Réponses du jeu du cas Noé et autres.
Réponses du jeu du cas Noé et autres.
Réponses du jeu du cas Noé et autres.

Proposé par Marie Claire C

A vous d'en trouver d'autres...

Réponses du jeu du cas Noé et autres.
Réponses du jeu du cas Noé et autres.
Réponses du jeu du cas Noé et autres.
Réponses du jeu du cas Noé et autres.


Et la petite dernière !

Réponses du jeu du cas Noé et autres.
Partager cet article
6 avril 2020 1 06 /04 /avril /2020 10:12
Voici le mail de Bernard en direct du labo du CHU de Nantes
Des nouvelles du front et du heros-mais-pas-trop-quand-même-faut-pas-pousser
La vague attendue n'est toujours pas arrivée malgré l'augmentation régulière des positifs dans nos séries de tests, et personne ne s"en plaindra: le confinement précoce de la région avant une trop grande répartition du virus dans la population y est surement pour qq chose. Mais rien ne nous dit comment va évoluer cette saloperie! restez vigilants et ne lachez rien le virus est partout. La semaine à venir peut être différente!
A propos des tests Covid19, je me suis dit que vous aimeriez peut être savoir comment ça se passe. Il ne faut pas compter sur Ouest France pour vous l'expliquer... Alors je vous joins un document pour tenter de vous expliquer simplement la technique PCR utilisée au labo. Vous avez aussi le droit de le mettre à la corbeille: il n'y aura pas de contrôle écrit à la rentrée!!
Prenez soin de vous et de vos proches
Des nouvelles du front et autres

Bonjour, J'ai récemment lu ça sur Ouest France : on vous a montré cette photo avec la légende : « test du Covid19 » ça m'a énervé... ça a l'air tellement simple qu'on se demande pourquoi on n'en fait pas à toute la population ! Seulement voilà, c'est juste un tout petit peu plus compliqué ! Ce tube contient seulement un liquide et l'écouvillon avec lequel on a prélevé dans le nez du patient. Il permet de transporter et protéger les cellules et les virus qu'il contient vers le labo où sera fait l'analyse. Comment se fait le test ? 2 étapes : 1 récupérer les acides nucléiques (ADN et ARN) qu'il contient 2 aller à la pêche pour amplifier l'ARN du Covid19 (PCR) 1- purification : après avoir bien touillé le liquide avec l'écouvillon, on récupère 0,2ml qu'on met immédiatement dans un tube qui contient une solution pour détruire les cellules et l'enveloppe du virus qu'elles contiennent pour libérer les acides nucléiques (AN : ADN et ARN). Là le virus est mort et on ne risque plus rien. Cette « soupe » est placée dans un automate qui va récupérer les AN et les dissoudre dans un liquide propre. Ca prend 45mn 2 On récupère 0,005ml (C pas bcp) de ce liquide que l'on dépose dans un nouveau tube qui contient 0,020ml d'un mélange où on va amplifier l'ARN du virus pour qu'il soit détectable. A l'échelle moléculaire, c'est repérer un gardon dans le lac de Genève

Comment ça marche : je vais prendre un exemple Vous voyez le lac de St julien (plus petit), il est plein de poissons différents et celui qu'on cherche est bien planqué avec les autres beaucoup plus nombreux. Alors on va multiplier le nombre de poissons Covid19 pour le démasquer : Si le Covid19 est présent, on va l'accrocher avec une amorce qui ne s'accroche qu'à lui et à partir d'un poisson Covid19, on va en créer 2, avec les 2 on en fait 4, avec les 4 on en fait 8, et ainsi de suite:16, 32, 64, 128, 256, 512, 1024 quand on a fait ça 45 fois, (45 cycles) on peut mathématiquement en avoir 2 exposant 45 ça fait beaucoup ! C'est ce qu'on appelle une réaction en chaîne (PCR : Polymerase Chain Reaction) on vous parle des fois du test PCR et bien c'est ça. Il faut 1h30 dans un automate : le thermocycleur Ben oui mais comment on les voit les nouveaux poissons ? me direz vous Imaginez : à chaque fois qu'on crée un nouveau poisson, on allume une led dans le lac de St Yo, on place un drone avec une camera au dessus du lac qui va pouvoir détecter l'augmentation de la lumière

En vrai ça donne ça : courbe de l'intensité lumineuse



Des nouvelles du front et autres

Ici la lumière (fluorescente) à été détectée dans le tube à partir du 25ème cycle et ils ont fait 50 cycles d'amplification. Évidemment plus vous avez de virus au départ et moins vous aurez besoin de cycles pour atteindre le seuil de détection, ça donne une idée du nombre de virus présents dans le prélèvement. En plaçant dans la série des tubes qui contiennent une quantité connue d'ADN viral, on peut même calculer le nombre de virus contenus dans l'échantillon de départ. Un peu de biologie moléculaire (si ça vous échappe demandez à vos bacheliers de l'année) Vous connaissez les briques (bases) qui composent l'ADN : A T C G L'amorce qui accroche le poisson c'est un petit morceau d'ADN avec une suite de 20 bases ATCG que l'on a fabriqué à partir de la séquence complète du génome viral publié par les chinois. GGCATTCGGACCTGATGGCATGCCCTTACCetc-------(genome du virus) TAAGCCTGGACTACCGTAC (amorce) le A s'accroche au T et le G s'accroche au C cette suite de bases a été choisie pour être unique et caractéristique du virus, elle ne peux pas accrocher aucune autre séquence. Une fois accroché, la suite de la multiplication de la séquence du virus se passe aussi au niveau de la séquence en utilisant des A T C G ,une enzyme (polymerase) qui va les accrocher en face de la séquence ciblée à partir d'amorces spécifiques. On utilise un marqueur fluorescent qui va émettre de la lumière à chaque nouvelle copie réalisée. Il y a des vidéo et des Schéma explicatifs sur le net, je pourrai aussi vous en dire plus si ça vous intéresse. Je vous remercie d'avoir lu jusqu'au bout (le mélange pour faire la PCR est fabriqué au labo, y'a pas que les allemands qui sachent faire ça!)

Et Voici le mot que  Céline m'a envoyé :

Tout d'abord merci de maintenir les liens du club en alimentant le site. 

Les petits mots des uns et des autres sont forts et fédérateurs.

De mon côté à  défaut de transpirer en faisant du sport ,

le sport m'a inspirée, alors à mon tour je partage ce petit texte, un jeu qui pourra si tu le souhaites être proposé à nos sportifs du RCN   

Des nouvelles du front et autres
Des nouvelles du front et autres
Des nouvelles du front et autres
Des nouvelles du front et autres

Et ma  dernière aquarelle

et pour en voir plus:


et   sitartheo

Des nouvelles du front et autres
Partager cet article


  • Groupe trailer 44
  •    Groupe vétéran  au sein de la section du Racing Club de Nantes à St Julien de Concelles .Nous préparons nos courses avec des objectifs communs et avec des athlètes de tous niveaux.Sport et convivialité sont les maîtres mots.
  • Groupe vétéran au sein de la section du Racing Club de Nantes à St Julien de Concelles .Nous préparons nos courses avec des objectifs communs et avec des athlètes de tous niveaux.Sport et convivialité sont les maîtres mots.
